Imported from PKU-YuanGroup/OpenAI4S (skills/bioskills/bio-primer-design-primer-specificity/SKILL.md). Install upstream with npx skills add PKU-YuanGroup/OpenAI4S --skill bio-primer-design-primer-specificity. Copyright stays with the author.

Version Compatibility

Reference examples tested with: primer3-py 2.3+ (offline prefilter). In-silico PCR tools: MFEprimer 3.x, UCSC isPcr, BLAST+ 2.14+, NCBI Primer-BLAST (web).

Before using code patterns, verify installed versions match. If versions differ:

• Python: pip show primer3-py then help(primer3.calc_end_stability) to check signatures
• CLI: mfeprimer --help, isPcr, blastn -help to confirm subcommands and flags

If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.

Primer Specificity -- Does the PAIR Amplify Only the Target Genome-Wide

"Are these primers specific?" -> Predict every amplicon the primer PAIR would generate against the correct database and confirm only the intended one survives -- because specificity is a property of a convergent, 3'-anchored, in-range PAIR, not of one primer's similarity to the genome.

• CLI: mfeprimer -i primers.fa -d genome.fa (or UCSC isPcr, or NCBI Primer-BLAST) predicts amplicons from the pair.
• Python: primer3.calc_end_stability(primer, site) ranks 3'-end anchoring -- the variable BLAST ignores.

Scope: genome/transcriptome-wide off-target and mispriming assessment of a chosen primer PAIR via in-silico PCR. Designing primers -> primer-basics. Intramolecular dimers/hairpins of the oligos -> primer-validation. General read alignment / building a BLAST DB -> read-alignment/bwa-alignment, database-access/blast-searches.

The Single Most Important Modern Insight -- Plain BLAST Is the Wrong Tool, Because Specificity Is a Property of a Predicted Amplicon, Not One Primer's Similarity

1. The unit of analysis is the amplicon, not the primer. Amplification needs four things at once: the forward primer anchored, the reverse primer anchored, the two convergent, and the gap within the polymerase's range. BLAST evaluates none of these as a set -- it scores per-query local similarity and stops. So a clean BLAST is false confidence in BOTH directions: a primer with a perfect 5' region but mismatched 3' bases scores a high BLAST hit yet will NOT prime (false off-target), while a primer with internal mismatches but a perfect 3' anchor WILL prime yet may fall below BLAST's word size and be missed (false negative).
2. The 3' terminus is the governing variable, and BLAST is blind to it. A single 3'-terminal mismatch suppresses extension by roughly 20-100x depending on identity (A:G/G:A/C:C worst, A:A intermediate, G:T/T:G wobble weakest and NOT automatically safe), while internal mismatches are tolerated (Kwok 1990 Nucleic Acids Res 18:999). BLAST maximizes total alignment score and cannot tell a 5' match from a 3' match. Pair-aware tools (Primer-BLAST, MFEprimer, isPcr) use BLAST or a k-mer index only as a candidate FINDER, then apply a pair + 3'-anchor + product-size FILTER.
3. Search the correct database or the answer is meaningless. For RT-qPCR, intron-spanning primers do NOT escape genomic DNA: processed pseudogenes are intronless retro-copies that typically carry the exon-exon junction (3'-truncated retrocopies may not), so when present they amplify like cDNA -- the search must cover the GENOME (with pseudogenes and alt/unplaced contigs), not the transcriptome only. This is the most common RT-qPCR specificity trap.

Why Plain BLAST Fails, Concretely

BLASTn defaults are wrong for a ~20 nt primer: megablast (the default blastn) seeds at word 28 and so cannot seed a 20-mer at all; plain blastn (word 11) does seed a perfect 20-mer, but its scoring and E-value defaults are tuned for long queries, so short or partial off-target hits fall below threshold; only blastn-short (word 7, short-query scoring) is the appropriate task -- and even then it scores similarity, not amplification. And BLAST evaluates each primer independently against the database; it never asks whether the forward and reverse hits face each other within an amplifiable span. So blastn-short is acceptable only as a quick EXPLORATORY check for gross multi-copy/repeat problems of a single primer, read with the 3' alignment inspected by hand -- never as the final specificity decision.

Tool Taxonomy

Decision Tree by Scenario

Default when uncertain: run pair-aware in-silico PCR (MFEprimer or Primer-BLAST) against the genome AND, for RT work, the transcriptome; require exactly one intended amplicon, no qualifying off-target, and 3' ends clear of common SNPs -- then still validate empirically.

Run In-Silico PCR on the Pair

Goal: Enumerate every amplicon the pair would make against the correct database and confirm only the intended one survives.

Approach: Build the database index once, run the pair-aware tool, and read the predicted products; require a single on-target amplicon of expected size and no qualifying off-target. The commands below need the tool binaries and a genome/transcriptome FASTA, so they are NOT offline-spot-runnable here -- verify flags with --help against the installed version.

# MFEprimer-3.0 (local, thermodynamic; build the k-mer index once, then run)
mfeprimer index -i genome.fa
mfeprimer -i primers.fa -d genome.fa -o specificity.txt        # add --json for pipeline parsing; verify flags with: mfeprimer --help

# UCSC isPcr (exact products on one assembly; primers.txt = "name<TAB>FWD<TAB>REV" per line)
isPcr genome.2bit primers.txt stdout -out=fa

# blastn-short: EXPLORATORY single-primer repeat scan ONLY (not a specificity verdict)
blastn -task blastn-short -word_size 7 -dust no -query primers.fa -db genome -outfmt 6

NCBI Primer-BLAST (web, any organism): paste the pair, pick the organism and a database that includes the genome (not "RefSeq mRNA only" for RT-qPCR), set the max product size, and read the report.

Rank Off-Target Sites by 3'-End Anchoring (offline)

Goal: Show why a candidate off-target site that BLAST would surface may or may not actually prime, using the 3'-anchor thermodynamics BLAST ignores.

Approach: For each candidate site (the complementary strand the primer would anneal to), contrast the overall duplex dG (calc_heterodimer, what a similarity search tracks) with the 3'-anchor dG (calc_end_stability); a 3'-terminal mismatch keeps the overall dG strong but collapses the anchor, so the site will not prime despite the similarity.

import primer3

COMP = str.maketrans('ACGT', 'TGCA')
primer = 'GTCTCCTCTGACTTCAACAGCG'
site = primer.translate(COMP)[::-1]                  # the strand the primer anneals to; primer 3' base pairs site[0]

def mut(s, i):
    return s[:i] + ('A' if s[i] != 'A' else 'C') + s[i + 1:]

sites = {'on-target': site, 'internal mismatch': mut(site, len(site) // 2), '3-prime mismatch': mut(site, 0)}

for label, s in sites.items():
    overall = primer3.calc_heterodimer(primer, s).dg / 1000   # what overall similarity tracks
    anchor = primer3.calc_end_stability(primer, s).dg / 1000  # the 3'-anchor BLAST ignores
    print(f'{label}: overall dG={overall:.2f}  3-prime anchor dG={anchor:.2f} kcal/mol')   # 3' mismatch: overall stays strong, anchor collapses

Per-Method Failure Modes

"BLAST was clean, so it is specific"

Trigger: Treating a per-primer BLAST result as a specificity verdict. Mechanism: BLAST scores similarity per primer, ignores 3'-anchoring and pairing. Symptom: primers pass BLAST but amplify off-target on the bench. Fix: use pair-aware in-silico PCR (MFEprimer / Primer-BLAST / isPcr).

Intron-spanning RT-qPCR checked against the transcriptome only

Trigger: Searching "RefSeq mRNA" and concluding gDNA-safe. Mechanism: processed pseudogenes are intronless and carry the junction, amplifying like cDNA. Symptom: a genomic amplicon at the cDNA size; no-RT control is positive. Fix: search the genome (with pseudogenes); keep DNase + no-RT control.

Misreading an empty Primer-BLAST "unintended" section

Trigger: Treating an empty section as proof of uniqueness. Mechanism: Primer-BLAST ignores any off-target with >=6 total mismatches OR >=2 mismatches in the last 5 bp at the 3' end -- equivalently it LISTS only hits with <6 total and <2 near the 3', so an empty section means "none my model predicts will amplify," not "none similar exist." Symptom: false confidence. Fix: loosen the mismatch settings to stress-test, and combine with isPcr.

Wrong / too-narrow database

Trigger: Searching primary assembly only, or one chromosome, or a single transcript set. Mechanism: off-targets on alt/unplaced contigs, repeats, or paralog transcripts are excluded. Symptom: "unique" in-silico, multiple bands in vitro. Fix: match the database to the assay (genome + transcriptome for RT-qPCR; include alt/unplaced contigs).

SNP/indel under the 3' end

Trigger: Validating against the reference only. Mechanism: an individual carrying a variant under the 3' anchor fails to amplify that allele (Kwok 1990 Nucleic Acids Res 18:999). Symptom: allele dropout in some samples. Fix: check primer 3' ends against dbSNP/gnomAD common variants and redesign (primer-basics).

Checking a multiplex pair-by-pair instead of pooled

Trigger: Per-pair Primer-BLAST/in-silico PCR on a multiplex set. Mechanism: two off-target classes only appear in the POOLED set -- inter-pair cross-dimers (O(N^2), unexamined) and cross-pair amplicons where one pair's forward meets another pair's reverse convergently and in-range. Symptom: one channel silently fails or an unexpected band appears. Fix: run in-silico PCR over the pooled primer set AND all-pairs cross-dimer screening (primer-validation), not pair-by-pair.

Quantitative Thresholds

In-Silico Reduces, It Does Not Replace, Empirical Validation

A passing in-silico check removes most bad designs but does not license an assay. Confirm empirically: a gradient PCR to find the annealing temperature giving a single product; a single band on a gel (or single fragment on a TapeStation); for SYBR qPCR a single sharp melt peak with no low-Tm dimer shoulder; and Sanger sequencing of the product to prove identity (a same-size off-target is invisible on a gel). State this honestly -- "Primer-BLAST said it is specific" is not validation of a quantitative assay.

Common Errors

References

• Ye J, Coulouris G, Zaretskaya I, et al. 2012. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics 13:134.
• Wang K, Li H, Xu Y, et al. 2019. MFEprimer-3.0: quality control for PCR primers. Nucleic Acids Res 47:W610-W613.
• Kwok S, Kellogg DE, McKinney N, et al. 1990. Effects of primer-template mismatches on the polymerase chain reaction: human immunodeficiency virus type 1 model studies. Nucleic Acids Res 18:999-1005.
• SantaLucia J Jr, Hicks D. 2004. The thermodynamics of DNA structural motifs. Annu Rev Biophys Biomol Struct 33:415-440.
• Altschul SF, Gish W, Miller W, et al. 1990. Basic local alignment search tool. J Mol Biol 215:403-410.

Related Skills

• primer-basics - Design (or redesign) primers when specificity fails
• primer-validation - Intramolecular dimers/hairpins of the chosen oligos
• qpcr-primers - qPCR assays where specificity and gDNA exclusion are mandatory
• read-alignment/bwa-alignment - Align candidate amplicons / reads to a genome
• database-access/blast-searches - Build/query BLAST databases for candidate finding